Skip to main content

Donggyu Jin

Sungkyunkwan University · Medicine

About the Lab

Professor Donggyu Jin's research lab specializes in the genetic and molecular mechanisms underlying lysosomal storage disorders, with a focus on mucolipidosis and Hunter syndrome (Mucopolysaccharidosis II). The lab investigates disease-causing mutations in key enzymes and associated genes, such as GNPTA, GNPTAG, and IDS, using molecular genetics and functional studies. They also explore clinical manifestations, including neurological and musculoskeletal complications like carpal tunnel syndrome, and evaluate therapeutic interventions such as enzyme replacement therapy. Their work bridges clinical genetics with structural biology, often integrating molecular diagnostics and 3D protein modeling to understand disease pathology.

lysosomal storage disordersMucopolysaccharidosis IIgene mutationsenzyme replacement therapygenetic diagnostics

Research Overview

Papers
445
Total Citations
5,734
Papers (5y)
45
Primary Field
Medicine

Research Output Trend

Figures are computed from collected data and may differ slightly.

Publications per year (5y)
45total
2020
2021
2022
2024
2025
Citations per year (5y)
375total
20202021202220242025

Selected Papers

15
1
Article|87 citations·2011
Identification of signal peptide domain SOST mutations in autosomal dominant craniodiaphyseal dysplasia
Su Jin Kim, Tadeusz Biegański, Young Bae Sohn, K. Kozlowski, Mikhail A. Semenov, Nobuhiko Okamoto, Chi Hwa Kim, Ah‐Ra Ko, Geung Hwan Ahn, Yoon‐La Choi, Sung Won Park, Chang‐Seok Ki
SJR Q1Human Genetics
OncologyMedicine
2
Article|78 citations·1996
Distribution of integrin subunits in human diabetic kidneys.
Dong‐Kyu Jin, A J Fish, Elizabeth A. Wayner, Michael Mauer, Suman Setty, Effie C. Tsilibary, Y. Kim
SJR Q1Journal of the American Society of NephrologyOA

Integrins are cell-surface protein receptors that participate in cell adhesion to multiple extracellular matrix ligands, and consist of alpha and beta chain heterodimers. This study examined altered integrin distribution in diabetic nephropathy by investigating 12 human diabetic kidney biopsies, which were compared with normal human kidney. Diabetic nephropathy is characterized by mesangial expansion and progressive thickening of the glomerular basement membrane. Based on morphometric studies of

Immunology and AllergyMedicine
3
Article|78 citations·2005
Identification of mutations in the GNPTA (MGC4170) gene coding for GlcNAc-phosphotransferase α/β subunits in Korean patients with mucolipidosis type II or type IIIA
Kyung Hoon Paik, Seng Song, Chang‐Seok Ki, Han-Wook Yu, Jung Sim Kim, Ki Hoon Min, Soo Hee Chang, Eun Jae Yoo, In Jung Lee, Eun Kyung Kwan, Sun Joo Han, Dong‐Kyu Jin
SJR Q1Human Mutation

Mucolipidosis types II and III are autosomal recessive inherited diseases caused by a deficiency in the lysosomal enzyme N-acetylglucosamine-1 phosphotransferase (GlcNAc-phosphotransferase), which adds phosphate to function as a recognition marker for the uptake and transport of lysosomal enzymes. We investigated mutations in the GNPTA (MGC4170) gene, which codes for the alpha/beta subunits of phosphotransferase, and in the GNPTAG gene, which codes for its gamma subunits in five Korean patients

PhysiologyBiochemistry, Genetics and Molecular Biology
4
Article|76 citations·2013
Phase I/II clinical trial of enzyme replacement therapy with idursulfase beta in patients with mucopolysaccharidosis II (Hunter Syndrome)
Young Bae Sohn, Sung Yoon Cho, Sung Won Park, Su Jin Kim, Ah‐Ra Ko, Eun-Kyung Kwon, Sun Ju Han, Dong‐Kyu Jin
SJR Q1Orphanet Journal of Rare DiseasesOA

BACKGROUND: Mucopolysaccharidosis II (MPS II, Hunter syndrome) is a rare X-linked lysosomal storage disorder caused by the deficiency of iduronate-2-sulfatase (IDS). In affected patients, glycosaminoglycan (GAG) accumulates in the lysosomes of many organs and tissues contributing to the pathology associated with MPS II. The objective of this phase I/II clinical study was to evaluate the efficacy and safety of recombinant human iduronate-2-sulfatase (idursulfase beta, Hunterase®) in the treatment

PhysiologyMedicine
5
Article|53 citations·1999
Frequency of spinocerebellar ataxia types 1, 2, 3, 6, 7 and dentatorubral pallidoluysian atrophy mutations in Korean patients with spinocerebellar ataxia
Dong‐Kyu Jin, Myung Ryurl Oh, Seng Song, Si Whan Koh, Munhyang Lee, G. M. Kim, Won‐Yong Lee, C Chung, Kwang Ho Lee, Joo Hyuk Im, Myung Lee, Jae Woo Kim
SJR Q1Journal of Neurology
Cellular and Molecular NeuroscienceNeuroscience
6
Article|53 citations·2014
Heterozygous mutations in cyclic AMP phosphodiesterase-4D (PDE4D) and protein kinase A (PKA) provide new insights into the molecular pathology of acrodysostosis
Tadashi Kaname, Chang‐Seok Ki, Norio Niikawa, George S. Baillie, Jonathan P. Day, Ken–ichi Yamamura, Tohru Ohta, Gen Nishimura, Nobuo Mastuura, Ok-Hwa Kim, Young Bae Sohn, Hyun Woo Kim
SJR Q2Cellular SignallingOA
Molecular BiologyBiochemistry, Genetics and Molecular Biology
7
Article|50 citations·2012
Familial Xp22.33‐Xp22.12 deletion delineated by chromosomal microarray analysis causes proportionate short stature
Sung Yoon Cho, Chang‐Seok Ki, Ja‐Hyun Jang, Young Bae Sohn, Sung Won Park, Se Hwa Kim, Sujin Kim, Dong‐Kyu Jin
SJR Q2American Journal of Medical Genetics Part A

Patients with Xp deletions have short stature and may have some somatic traits typical of Turner syndrome (TS), whereas gonadal function is generally preserved. In most studies of these patients, microsatellites have been used to determine the break point of the Xp deletion. In the present study, we describe the clinical, cytogenetic, and chromosomal microarray (CMA) analysis of a family with an Xp22.33-Xp22.12 deletion. Two female siblings, aged 8 years 9 months and 11 years 10 months, presente

GeneticsBiochemistry, Genetics and Molecular Biology
8
Article|47 citations·2011
High prevalence of carpal tunnel syndrome in children with mucopolysaccharidosis type II (Hunter syndrome)
Jeong‐Yi Kwon, Kiljun Ko, Young Bae Sohn, Su Jin Kim, Sung Won Park, Se‐Hwa Kim, Sung‐Yoon Cho, Dong‐Kyu Jin
SJR Q2American Journal of Medical Genetics Part A

Although carpal tunnel syndrome (CTS) is the most common compressive neuropathy seen in the upper extremity of adults, it is rarely seen in children. Several reports have shown that mucopolysaccharidosis type II (Hunter syndrome), a rare genetic disorder, is one of the causes of CTS in children. Usual symptoms of CTS are pain, weakness, and paresthesias in the hand and digits. However, the diagnosis of CTS in Hunter syndrome is often delayed or unrecognized because of atypical symptoms and cogni

PhysiologyMedicine
9
Article|46 citations·2003
Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: Identification of 13 novel mutations
Chi Hwa Kim, Hye Zin Hwang, Seng Song, Kyung Hoon Paik, Eun Kyung Kwon, Kwang Bin Moon, Jeong Hyeok Yoon, Cheol Han, Dong‐Kyu Jin
SJR Q1Human MutationOA

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T)

PhysiologyMedicine
10
Article|39 citations·2016
BGN Mutations in X-Linked Spondyloepimetaphyseal Dysplasia
Sung Yoon Cho, Jun-Seok Bae, Nayoung K. D. Kim, Francesca Forzano, Katta M. Girisha, Chiara Baldo, Francesca Faravelli, Tae‐Joon Cho, Dongsup Kim, Kyoung Yeul Lee, Shiro Ikegawa, Jong Sup Shim
SJR Q1The American Journal of Human GeneticsOA
GeneticsBiochemistry, Genetics and Molecular Biology
11
Article|39 citations·2005
Increased Density of Ghrelin-Expressing Cells in the Gastric Fundus and Body in Prader-Willi Syndrome
Yon Ho Choe, Sang Yong Song, Kyung‐Hoon Paik, Yoo Joung Oh, Su-Hyun Chu, Sung Hee Yeo, Eun Kyung Kwon, Eun‐Mee Kim, Mee Yong Rha, Dong‐Kyu Jin
SJR Q1The Journal of Clinical Endocrinology & MetabolismOA

CONTEXT: The levels of ghrelin, an orexigenic hormone secreted by oxyntic cells in the digestive tract, are elevated in Prader-Willi syndrome (PWS) and GH deficiency (GHD) patients. In this study, we hypothesized that the hyperghrelinemia observed in PWS is related to IGF-I or GH/IGF axis deficiency. DESIGN: We investigated the densities of ghrelin-expressing cells (GECs), the amounts of ghrelin in gastric tissues, and ghrelin levels in plasma in 16 PWS patients and compared these results with t

GeneticsBiochemistry, Genetics and Molecular Biology
12
Article|39 citations·2010
Characterization of a Novel Mucopolysaccharidosis Type II Mouse Model and Recombinant AAV2/8 Vector-Mediated Gene Therapy
Sung‐Chul Jung, Eun Sook Park, Eun Nam Choi, Chi Hwa Kim, Su Jin Kim, Dong‐Kyu Jin
SJR Q1Molecules and Cells
PhysiologyMedicine
13
Article|37 citations·2019
Effects of recombinant human growth hormone treatment on growth, body composition, and safety in infants or toddlers with Prader-Willi syndrome: a randomized, active-controlled trial
Aram Yang, Jin‐Ho Choi, Young Bae Sohn, Yunae Eom, Ji Yoon Lee, Han‐Wook Yoo, Dong‐Kyu Jin
SJR Q1Orphanet Journal of Rare DiseasesOA

BACKGROUND: Prader-Willi syndrome (PWS) is a rare complex genetic disorder and is characterized by short stature, muscular hypotonia, abnormal body composition, psychomotor retardation, and hyperphagia. Recombinant human growth hormone (rhGH) treatment improves the symptoms in children with PWS, and early treatment results in more favorable outcomes. However, systematic studies in infants and toddlers under 2 years of age are lacking. This multicenter, randomized, active-controlled, parallel-gro

GeneticsBiochemistry, Genetics and Molecular Biology
14
Article|35 citations·2005
Hyperghrelinemia Does Not Accelerate Gastric Emptying in Prader-Willi Syndrome Patients
Yon Ho Choe, Dong‐Kyu Jin, Sang Eun Kim, Sang Yong Song, Kyung Hoon Paik, Hwa Young Park, Yoo Joung Oh, An Hee Kim, Jung Sim Kim, Chi Wha Kim, Su-Hyun Chu, Eun Kyung Kwon
SJR Q1The Journal of Clinical Endocrinology & MetabolismOA

Prader-Willi syndrome (PWS) is the most common form of syndromic obesity associated with hyperphagia. Because ghrelin stimulates gastric motility in rodents, and PWS patients have 3- to 4-fold higher fasting plasma ghrelin concentrations than normal subjects, we hypothesized that hyperphagia associated with PWS may be partly explained by rapid gastric emptying due to the increased gastric motility caused by ghrelin. We determined gastric emptying times (GETs) and measured ghrelin levels in 11 PW

GeneticsBiochemistry, Genetics and Molecular Biology
15
Article|34 citations·2011
Systematic review of the clinical and genetic aspects of Prader-Willi syndrome
Dong‐Kyu Jin
Korean Journal of PediatricsOA

Prader-Willi syndrome (PWS) is a complex multisystem genetic disorder that is caused by the lack of expression of paternally inherited imprinted genes on chromosome 15q11-q13. This syndrome has a characteristic phenotype including severe neonatal hypotonia, early-onset hyperphagia, development of morbid obesity, short stature, hypogonadism, learning disabilities, behavioral problems, and psychiatric problems. PWS is an example of a genetic condition caused by genomic imprinting. It can occur via

GeneticsBiochemistry, Genetics and Molecular Biology

Research Areas

GeneticsPhysiologySurgeryEndocrinology, Diabetes and MetabolismCardiology and Cardiovascular MedicineMolecular Biology

Dive deeper into Donggyu Jin's research on Nubint

Open this lab's papers in the app to read with AI, summarize, and cite in your writing.