진동규 교수

Integrins are cell-surface protein receptors that participate in cell adhesion to multiple extracellular matrix ligands, and consist of alpha and beta chain heterodimers. This study examined altered integrin distribution in diabetic nephropathy by investigating 12 human diabetic kidney biopsies, which were compared with normal human kidney. Diabetic nephropathy is characterized by mesangial expansion and progressive thickening of the glomerular basement membrane. Based on morphometric studies of

Mucolipidosis types II and III are autosomal recessive inherited diseases caused by a deficiency in the lysosomal enzyme N-acetylglucosamine-1 phosphotransferase (GlcNAc-phosphotransferase), which adds phosphate to function as a recognition marker for the uptake and transport of lysosomal enzymes. We investigated mutations in the GNPTA (MGC4170) gene, which codes for the alpha/beta subunits of phosphotransferase, and in the GNPTAG gene, which codes for its gamma subunits in five Korean patients

BACKGROUND: Mucopolysaccharidosis II (MPS II, Hunter syndrome) is a rare X-linked lysosomal storage disorder caused by the deficiency of iduronate-2-sulfatase (IDS). In affected patients, glycosaminoglycan (GAG) accumulates in the lysosomes of many organs and tissues contributing to the pathology associated with MPS II. The objective of this phase I/II clinical study was to evaluate the efficacy and safety of recombinant human iduronate-2-sulfatase (idursulfase beta, Hunterase®) in the treatment

Patients with Xp deletions have short stature and may have some somatic traits typical of Turner syndrome (TS), whereas gonadal function is generally preserved. In most studies of these patients, microsatellites have been used to determine the break point of the Xp deletion. In the present study, we describe the clinical, cytogenetic, and chromosomal microarray (CMA) analysis of a family with an Xp22.33-Xp22.12 deletion. Two female siblings, aged 8 years 9 months and 11 years 10 months, presente

Although carpal tunnel syndrome (CTS) is the most common compressive neuropathy seen in the upper extremity of adults, it is rarely seen in children. Several reports have shown that mucopolysaccharidosis type II (Hunter syndrome), a rare genetic disorder, is one of the causes of CTS in children. Usual symptoms of CTS are pain, weakness, and paresthesias in the hand and digits. However, the diagnosis of CTS in Hunter syndrome is often delayed or unrecognized because of atypical symptoms and cogni

Hunter syndrome (Mucopolysaccharidosis type II, MPS2) is an X-linked recessively inherited disease caused by a deficiency of iduronate 2 sulfatase (IDS). In this study, we investigated mutations of the IDS gene in 25 Korean Hunter syndrome patients. We identified 20 mutations, of which 13 mutations are novel; 6 small deletions (69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (21_22insG, 683_684insC), 2 terminations (529G>T, 637A>T)

CONTEXT: The levels of ghrelin, an orexigenic hormone secreted by oxyntic cells in the digestive tract, are elevated in Prader-Willi syndrome (PWS) and GH deficiency (GHD) patients. In this study, we hypothesized that the hyperghrelinemia observed in PWS is related to IGF-I or GH/IGF axis deficiency. DESIGN: We investigated the densities of ghrelin-expressing cells (GECs), the amounts of ghrelin in gastric tissues, and ghrelin levels in plasma in 16 PWS patients and compared these results with t

BACKGROUND: Prader-Willi syndrome (PWS) is a rare complex genetic disorder and is characterized by short stature, muscular hypotonia, abnormal body composition, psychomotor retardation, and hyperphagia. Recombinant human growth hormone (rhGH) treatment improves the symptoms in children with PWS, and early treatment results in more favorable outcomes. However, systematic studies in infants and toddlers under 2 years of age are lacking. This multicenter, randomized, active-controlled, parallel-gro

Prader-Willi syndrome (PWS) is the most common form of syndromic obesity associated with hyperphagia. Because ghrelin stimulates gastric motility in rodents, and PWS patients have 3- to 4-fold higher fasting plasma ghrelin concentrations than normal subjects, we hypothesized that hyperphagia associated with PWS may be partly explained by rapid gastric emptying due to the increased gastric motility caused by ghrelin. We determined gastric emptying times (GETs) and measured ghrelin levels in 11 PW

Prader-Willi syndrome (PWS) is a complex multisystem genetic disorder that is caused by the lack of expression of paternally inherited imprinted genes on chromosome 15q11-q13. This syndrome has a characteristic phenotype including severe neonatal hypotonia, early-onset hyperphagia, development of morbid obesity, short stature, hypogonadism, learning disabilities, behavioral problems, and psychiatric problems. PWS is an example of a genetic condition caused by genomic imprinting. It can occur via